circad | circRNAs associated with diseases

has-circRNA_0046367
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Hepatic Steatosis	ICD-10	Fatty (change of) liver, not elsewhere classified (K76.0)
DBLink	Link to database	PMID	29018509
Experimental Method
Sample Type	Liver tissues and HepG2 cells	Comparison	Five patients with biopsy-proven hepatic steatosis (5 of nonalcoholic fatty liver disease (NAFLD), age: 51.60 � 12.10; male/female: 3/2) and 3 nonsteatosis controls (2 of chronic hepatitis B (CHB), 1 of primary biliary cirrhosis (PBC), age: 55.00 � 18.19; male/female: 1/2)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTCGCTTCGGCAGCACA Reverse AACGCTTCACGAATTTGCGT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Guo, XY, Chen, JN, Sun, F, Wang, YQ, Pan, Q, Fan, JG (2017). circRNA_0046367 Prevents Hepatoxicity of Lipid Peroxidation: An Inhibitory Role against Hepatic Steatosis. Oxid Med Cell Longev, 2017:3960197.